BIO211 - CELLULAR AND ORGANISMAL BIOLOGY

Lecture Outline for March 11, 2005

 

Topics: translation

Chapter 13 section 13.3

Figures used in lecture:  Table 13.1, figures 13.11 through 13.15, Table 13.2

Additional Resources

Translation

 

Central Dogma: DNA codes for the production of RNA (transcription), RNA codes for the production of protein (translation), and proteins do not codes for the production of DNA, RNA, or protein

 

DNA gene genotype

transcription

RNA

translation

 

protein enzyme phenotype

 

 

Transcription

Define: messenger RNA (mRNA), template strand, RNA polymerase, promoter, termination signal

You should be able to

1. Explain the purpose of transcription within the framework of the Central Dogma.

2. Describe the steps of transcription including the functions of RNA polymerase.

3. Explain how the RNA polymerase "knows" what parts of the chromosome to transcribe.

 

Translation

Define: ribosomal RNA (rRNA), transfer RNA(tRNA), codon, genetic code, start codon, stop codon, anticodon,

You should be able to

1. Explain the purpose of translation in the framework of the Central Dogma.

2. Examine a mRNA sequence, identify the start and stop codons, and translate the mRNA sequence to polypeptide sequence.

 

 

Translation:

 

 

Codon

 

start codon: AUG - first codon read by the ribosome; codes for methionine

stop codons: last codon read by the ribosome

- do not code for an amino acid

- UAA, UAG, UGA

 

Anticodon

 

In-class exercise

practice DNA sequence mRNA sequence of codons amino acid sequence

 

DNA sequence: 3 AATCATTGTACAAACGGTATCGTGGCCTGCATATC 5

 

RNA sequence 5 UUAGUAACAUGUUUGCCAUAGCACCGGACGUAUAG 3

 

5 UUAGUAAC AUG UUU GCC AUA GCA CCG GAC GUA UAG 3

 

amino acid sequence met phe ala iso ala pro asp val